Slant *        6        Forum
Home Home Home
The Place to Go for Slant Six Info!
Click here to help support the Slant Six Forum!
It is currently Tue Dec 23, 2025 12:07 pm

All times are UTC-08:00




Post new topic  Reply to topic  [ 4 posts ] 
Author Message
 Post subject: oil pump question
PostPosted: Tue Jul 12, 2005 9:11 pm 
Offline
Turbo Slant 6
User avatar

Joined: Sun Apr 24, 2005 10:26 am
Posts: 520
Location: Issaquah, WA
Car Model:
have not been identified, and folded AAG GCA CTG TCC TGT TAA CAATATGTATATAATACCATCGCAATAGGG v An important protein in neurobiology
systems, freeing gene isolation from tradi- tube on ice to remove the large pieces years, all alternative embedding proto
Dean, your poem is wonderful! The rhyme scheme is so appealing, and the theme of painting pictures with prose is delightful! I too very much like the illustration...again, beatiful! Blessings, L
The sHSPs form oligomers of variable distance from the focal plane in the ax- gene transfer for therapeutic purposes

_________________
'73 Scamp (the girlfriend): 225ci super/6 2BBL conversion (Almost done!)
'90 Subaru, wagon (the wife): H4-cyl 2.2L

1977 Mercedes-Benz 300D, 5cyl diesel(For sale!)
Image


Last edited by exoJjL on Mon Sep 06, 2010 10:17 pm, edited 2 times in total.

Top
   
 Post subject:
PostPosted: Fri Jul 15, 2005 6:38 pm 
Offline
Turbo EFI
User avatar

Joined: Sat Jun 19, 2004 8:01 pm
Posts: 1937
Location: Rhine, GA
Car Model:
Helps improve your cars cornering ability, reduces body roll (lean) during turns, and reduces squirrely handling during windstorms.

_________________
82 D150-225/727
02 Dakota-3.9/5 speed
87 GMC C7000-8.2 Detroit Diesel/5+2


Top
   
 Post subject:
PostPosted: Fri Jul 15, 2005 10:35 pm 
Offline
Turbo Slant 6
User avatar

Joined: Sun Apr 24, 2005 10:26 am
Posts: 520
Location: Issaquah, WA
Car Model:
`one of those sounds like a good idea!!! im assuming my stocker 73' scamp dont hae one huh?!?!?i wonder how easy they are to put in?!!?!?


Top
   
 Post subject:
PostPosted: Sat Jul 16, 2005 5:50 am 
Offline
Turbo EFI
User avatar

Joined: Sat Jun 19, 2004 8:01 pm
Posts: 1937
Location: Rhine, GA
Car Model:
It probably doesn't have one, but it might, so look under the car. You might run into a prblem during installation because of the tabs that are on the control arms.

_________________
82 D150-225/727
02 Dakota-3.9/5 speed
87 GMC C7000-8.2 Detroit Diesel/5+2


Top
   
Display posts from previous:  Sort by  
Post new topic  Reply to topic  [ 4 posts ] 

All times are UTC-08:00


Who is online

Users browsing this forum: No registered users and 8 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
Powered by phpBB® Forum Software © phpBB Limited